معلومة

لماذا نستخدم طرق تسلسل الحمض النووي مثل البندقية؟

لماذا نستخدم طرق تسلسل الحمض النووي مثل البندقية؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا أتعلم عن استنساخ الحمض النووي لأول مرة. ما أفهمه هو أنه من أجل استنساخ الحمض النووي ، نقوم بتفكيك الجين الأصلي إلى أشلاء. ثم حاول إعادة تجميعها معًا.

لماذا بالضبط نفعل هذا؟ بدلاً من ذلك ، أليس من الأفضل استنساخ قاعدة واحدة في كل مرة؟ في الأساس في الكود الزائف:

old_dna_strand = 'ACTCATGCGAGCGTCAGTAGTACGTACTG' new_dna = "" للقاعدة في old_dna_strand: new_dna + = القاعدة

هذا يبدو أسهل بكثير وأقل عرضة للأخطاء. لماذا لدينا طرق غريبة مثل البندقية؟

شكرا لك مقدما. اسمحوا لي أن أعرف ما إذا كان ينبغي علي توضيح أو تحديث أي شيء في هذا السؤال.


هذه تقنية من "الزمن القديم" لتسلسل الجينوم. الطريقة الأساسية للتسلسل هي طريقة إنهاء سلسلة Sanger والتي يمكن أن تقرأ طولًا بين 100 و 1000 زوج أساسي (اعتمادًا على الأدوات المستخدمة). هذا يعني أنه يجب عليك تفكيك جزيئات الحمض النووي الأطول واستنساخها وتسلسلها لاحقًا. هناك طريقتان ممكنتان.

الأول يسمى المشي الكروموسوم (أو التمهيدي) ويبدأ بتسلسل القطعة الأولى. القطعة التالية من الحمض النووي (والتي تستخدم بعد ذلك أساسًا محددًا من نهاية التسلسل. يتم بعد ذلك تسلسل القطعة التالية (المجاورة) من التسلسل باستخدام أساس تمهيدي مكمل لنهاية التسلسل الأول الذي تمت قراءته وما إلى ذلك. لا تتطلب هذه التقنية الكثير من التجميع ، لكنك تحتاج إلى الكثير من البادئات وهي بطيئة نسبيًا.

للتغلب على هذه المشكلة ، تم تطوير طريقة تسلسل البندقية. هنا يتم تقسيم الحمض النووي إلى قطع مختلفة (ليست كلها مكسورة في نفس المكان) ، ويتم استنساخها وتسلسلها باستخدام مواد أولية خاصة بالناقل المستخدم في الاستنساخ. يؤدي إلى تسلسلات متداخلة يجب تجميعها بعد ذلك في تسلسل واحد على الكمبيوتر. تسمح هذه الطريقة بالتوازي مع التسلسل (يمكنك تحضير الكثير من تفاعلات التسلسل في نفس الوقت وتشغيلها) مما يجعل العملية أسرع بكثير ويتجنب أيضًا الحاجة إلى بادئات محددة التسلسل. تكمن المشاكل في تسلسل التسلسلات المتكررة ، حيث أن التداخلات ليست واضحة هنا. لحل هذه المشكلات ، يتم عمل مسودة أولى ثم إعادة ترتيب المناطق الحرجة باستخدام تقنيات أخرى مثل المشي التمهيدي. ألق نظرة على صفحة ويكيبيديا حول تسلسل البندقية إذا كنت ترغب في قراءة المزيد من التفاصيل.


تحليل التسلسل

مقدمة في تحليل التسلسل

تحليل التسلسل هو مصطلح يمثل بشكل شامل التحليل الحسابي لتسلسل الحمض النووي أو الحمض النووي الريبي أو الببتيد ، لاستخراج المعرفة حول خصائصه ووظيفته البيولوجية وبنيته وتطوره. لإجراء تحليل التسلسل بكفاءة ، من المهم أولاً فهم مصدر البيانات ، أي الطرق التجريبية المختلفة المستخدمة لتحديد التسلسل البيولوجي. نحتاج بعد ذلك إلى اتباع استراتيجيات تحليلية ، اعتمادًا على ما إذا كان التسلسل جينوميًا أم نسبيًا أم بروتينيًا. ستحتاج قواعد البيانات التي تخزن حاليًا البيانات الهائلة عن هذه الجزيئات الحيوية إلى التحقق أولاً من وجود تسلسلات مماثلة ، والتي قد توجه المقايسات التجريبية للتحقيقات الوظيفية. غالبًا ما تُستخدم أدوات البرمجيات وخدمات الويب لإجراء تحليل المعلوماتية الحيوية. بعد تحليل تسلسل الحمض النووي والحمض النووي الريبي والبروتين ، من المهم فهم كيفية ارتباطها بالبروتين برسم خرائط الجينوم. يجب أيضًا دراسة الجزيئات العضوية الصغيرة أو المستقلبات الضرورية للكائنات الحية لتعيش وتنمو في سياق تفاعلها مع الجينات والبروتينات ، عبر المسارات الأيضية. تهدف هذه المقالة إلى تقديم نظرة عامة على تحليل التسلسل ، على مستويات الحمض النووي ، والحمض النووي الريبي والبروتينات ، مع مسارات التمثيل الغذائي التي تصف تفاعلها.


طرق التسلسل الجرثومي

اكتساب نظرة جينية نقدية للبكتيريا والفيروسات من خلال التسلسل الجرثومي. سواء كنت تجري دراسات الميتاجينوميات ، أو تراقب تفشي الأمراض ، فإن قاعدتنا الواسعة من أساليب تسلسل الجيل التالي الميكروبي (NGS) ستساعدك على اكتشاف الإجابات بشكل أسرع وأكثر كفاءة مما كنت تعتقد أنه ممكن.

تسمح لك الكواشف والبرامج سهلة الاستخدام بالتحرك بسلاسة من خلال سير عمل التسلسل ، من إعداد العينة إلى التفسير البيولوجي للبيانات. تعرف على المزيد حول مجموعة متنوعة من طرق التسلسل الميكروبي أدناه.

اكتشف طرق التسلسل الجرثومي

16S وتسلسل الرنا الريباسي الخاص بـ ITS

16S وتسلسل RNA الريبوسومي (ITS) الفاصل الداخلي للرايبوسوم (rRNA) هي طرق تسلسل أمبليكون شائعة تستخدم لتحديد ومقارنة البكتيريا أو الفطريات الموجودة داخل عينة معينة ، ويمكن تحديد السلالات التي قد لا يمكن العثور عليها باستخدام الطرق التقليدية.

ميتاجينوميكس البندقية

مع القدرة على الجمع بين العديد من عينات التسلسل الميكروبي في جولة واحدة والحصول على تغطية تسلسلية عالية لكل عينة ، يمكن أن يكشف التسلسل الميتاجينومي للبندقية عن أعضاء الوفرة المنخفضة جدًا في المجتمع الميكروبي الذي قد يتم تفويته بالطرق الأخرى.

تحليل النسخ الميكروبية

على عكس الأساليب القائمة على التهجين مثل المصفوفات الدقيقة ، يتيح تسلسل الحمض النووي الريبي الميكروبي تحديدًا غير متحيز خاصًا بالحبلا للنصوص الشائعة والجديدة.

التسلسل الجرثومي للجينوم الكامل

يسمح تسلسل الجينوم الكامل (WGS) المستند إلى NGS للباحثين في علم الأحياء الدقيقة بتسلسل مئات الكائنات الحية بقوة مضاعفة الإرسال. على عكس الطرق التقليدية ، ليست هناك حاجة لخطوات استنساخ كثيفة العمالة.

أحدث قصص بحوث التسلسل الجرثومي

نوفوجين الصينية هي قوة عالمية

أكمل مزود خدمات NGS 1.2 مليون عينة - وقد بدأوا للتو

حان الوقت الآن لدراسات الميكروبيوم

يوفر تسلسل الجينوم الكامل للبندقية والنسخ للباحثين وشركات الأدوية بيانات لتحسين اكتشاف الأدوية وتطويرها.

يتوسع اختبار COVIDSeq ليشمل المزيد من العملاء

يعمل تعديل FDA الثاني على تعزيز قوة أجهزة تسلسل Illumina الإضافية لاختبار COVID-19

دليل الطرق

الوصول إلى المعلومات التي تحتاجها - من BeadChips إلى إعداد المكتبة لدراسات الجينوم ، أو النسخ ، أو دراسات الإيبيجينوم لاختيار التسلسل ، والتحليل ، والدعم - كل ذلك في مكان واحد. حدد أفضل الأدوات لمختبرك من خلال دليلنا الشامل المصمم خصيصًا لتطبيقات البحث.

منتجات الجينوم الميكروبي

قم بالوصول إلى قائمة شاملة من المنتجات لتسلسل الجينومات الميكروبية الكاملة ، و mRNA ، والعينات البيئية ، والمناطق المستهدفة ، والمناطق المحددة خصيصًا ، ومناطق ربط البروتين ، والمزيد.

تسلسل فيروس الإيبولا

يُمكِّن تسلسل Illumina الباحثين الميكروبيين من تتبع فاشيات الإيبولا وفهم تأثير معدل الطفرات السريع للفيروس.

نصائح إضافية

ابحث عن المزيد من المحتوى الخاص بعلم الأحياء الدقيقة

تتيح لك ميزة "الروابط الموصى بها & quot سهلة الاستخدام العثور بسهولة على المحتوى والمنتجات ذات الصلة بعلم الجينوم الميكروبي و / أو أي مجال آخر محدد من مجالات الاهتمام. يمكنك الوصول إلى هذا الخيار من أعلى أي صفحة من صفحات illumina.com.

استكشف الموارد وأدوات أمبير للمستخدمين الجدد

نحن نقدم التدريب وكل شيء آخر لسير عملك ، من البداية إلى النهاية. من التعرف على تقنيتنا إلى فهم بياناتك ، وشراء ما تحتاجه ، والحصول على الدعم ، سنهيئك للنجاح.

هل أنت مهتم بتلقي رسائل إخبارية ودراسات حالة ومعلومات عن الجينوميات الميكروبية؟ أدخل عنوان بريدك الالكتروني.

الموارد المميزة

التسلسل الميكروبي المستند إلى NGS

شاهد مقدمة لتسلسل الجيل التالي (NGS) وتطبيقاته في علم الأحياء الدقيقة.

مراجعة بحث التسلسل الفيروسي

اقرأ النقاط البارزة من المنشورات الحديثة التي توضح استخدام تقنيات تسلسل Illumina في علم الفيروسات.

كتيب نظرة عامة على الجينوميات الميكروبية

تمكين علم الجينوم الميكروبي بأدوات المعلومات الحيوية القوية.

تدفقات عمل NGS لعلم الأحياء الدقيقة

تعرف على حلول سير عمل التسلسل الشامل لملف تعريف المجموعات الميكروبية وتطورها ووظيفتها.

تدفقات عمل NGS لعلم الأحياء الدقيقة

تقنيات مبتكرة

هدفنا في Illumina هو تطبيق تقنيات مبتكرة لتحليل التباين الجيني والوظيفة ، مما يجعل الدراسات الممكنة التي لم يكن من الممكن تخيلها حتى قبل بضع سنوات فقط. من المهم بالنسبة لنا تقديم حلول مبتكرة ومرنة وقابلة للتطوير لتلبية احتياجات عملائنا. بصفتنا شركة عالمية تضع قيمة عالية للتفاعلات التعاونية ، والتسليم السريع للحلول ، وتوفير أعلى مستوى من الجودة ، فإننا نسعى جاهدين لمواجهة هذا التحدي. تعمل تقنيات التسلسل والصفيف المبتكرة من Illumina على تعزيز التقدم الرائد في أبحاث علوم الحياة ، والجينوميات الانتقالية والمستهلكين ، والتشخيص الجزيئي.

للاستخدام البحثي فقط. ليس للاستخدام في إجراءات التشخيص (باستثناء ما هو مذكور على وجه التحديد).


تسلسل الجيل التالي: البندقية مقابل أمبليكون

ما هي تقنية التسلسل الأفضل لتحليل العينات الميدانية؟

فريق البحث يجمع العينات في البرازيل.

الصورة مقدمة من مايكل تيسلر.

يمكن لتسلسل الجيل التالي (NGS) تحديد أنواع الكائنات الحية الموجودة في موقع معين باستخدام الحمض النووي البيئي (eDNA). إن إمكانات مثل هذه البيانات في العلوم البيئية والصحة العامة هائلة. على سبيل المثال ، لاحظ الباحثون الاختلافات الجغرافية في تكوين ميكروبيوم الأمعاء البشرية من خلال تسلسل العزلات الميكروبية من عينات مياه الصرف الصحي.

لتعزيز هذه الجهود ، قرر مايكل تيسلر من المتحف الأمريكي للتاريخ الطبيعي وزملاؤه تحديد طريقة تسلسل الجيل التالي الأكثر فاعلية لتحليل eDNA. بعد جمع سلسلة من العينات من أربعة سهول نهرية برازيلية ، قارنوا تسلسل البندقية (التسلسل العشوائي للجينومات الكاملة) مع تسلسل أمبليكون من جين 16S الريبوسوم RNA على منصات Illumina و Roche 454 ، على التوالي.

قال تيسلر: "كانت المقارنات واضحة نسبيًا". يستخدم تسلسل الحمض النووي البروتوكولات والأدوات القياسية لكل من amplicon والبندقية. بمجرد أن نحصل على التسلسلات ، اخترنا مصنفين تصنيفيين شائع الاستخدام ، ولكن هناك العديد من قواعد البيانات والمصنفات التي يمكن استخدامها لهذه الأنواع من الدراسات ".

قارن الفريق 49 عينة لتنوع الشعب البكتيري والعائلات ووجد أن تسلسل الأمبليكون قد حدد ضعف عدد الشعب ، بما في ذلك أربعة لم يتم تمثيلها في قاعدة بيانات تسلسل الجينوم الكامل للمعاهد الوطنية للصحة. حدد تسلسل Amplicon أيضًا عددًا أكبر من العائلات البكتيرية عند مقارنتها بتسلسل البندقية. من الناحية البيئية ، تتوافق بيانات تسلسل amplicon بشكل وثيق مع الثراء التصنيفي والوفرة وتكوين المجتمع لكل من السهول الفيضية الأربعة مقارنة ببيانات البندقية.

يعتقد Tessler أن سبب هذه التناقضات ، جزئيًا ، هو أن متواليات 16S RNA يتم تمثيلها بشكل أفضل في قواعد البيانات. "تسلسل amplicon المستهدف لـ 16S راسخ نسبيًا ويعتمد على قاعدة بيانات واسعة النطاق. ينتج عن تسلسل البندقية الكثير من الأجزاء الجينومية العشوائية ، لكن قواعد بيانات الجينوم الكبيرة مطلوبة لتحديد تلك التسلسلات. وقال إن عددًا من الشعب ليس له ببساطة أي ممثل له جينومات متسلسلة ".


تساعد مهمة تسلسل الحمض النووي

تسلسل الحمض النووي هو الطريقة التي يتم فيها تحديد تسلسل النوكليوتيدات في جزيء الحمض النووي. لذلك يتم استخدام أنواع مختلفة من الأساليب والتقنيات لهذه الطريقة. بعض التقنيات الأساسية هي:

تستخدم طريقة Maxam-Gilbert وضع العلامات المشعة ويتم استخدام الخيط المنقى الذي تم الحصول عليه من هذه العينة في مزيد من تقنيات الاستنساخ.

تم تطوير طريقة إنهاء السلسلة بواسطة Sanger ، وتسمى أيضًا طريقة Sanger. في هذه الطريقة ، يتم استخدام عدد أقل من المواد الكيميائية والمواد المشعة مقارنة بطريقة Maxam-Gilbert. تستخدم هذه الطريقة في الجيل الأول من الحمض النووي.

هذه ليست سوى التقنيات الأساسية لتسلسل الحمض النووي ، ولكن مع مرور الوقت والتقدم تم أيضًا إدخال العديد من التقنيات الأخرى ، مثل:

تسلسل البندقية: تُستخدم طريقة التسلسل هذه لتحليل شظايا الحمض النووي التي تزيد عن 1000 زوج قاعدي.

جسر PCR: في حالته ، تتشكل مستعمرات الحمض النووي عن طريق تضخيم الشظايا الموجودة على البادئات.

إلى جانب التقنيات المذكورة أعلاه ، فإن بعض التقنيات التي تستخدم تكلفة منخفضة وبالتالي توفر نتائج فعالة. البعض منهم:

  • التسلسل الصلب
  • تسلسل Illumina
  • تسلسل بولوني
  • MPSS
  • تسلسل SMRT وغيرها الكثير.

كل طرق التسلسل هذه لها منهجية وعمليات مختلفة ، بعضها فعال لإعطاء نتيجة واحدة ويمكن تطبيق البعض الآخر في مجال مختلف. ما تم ذكره أعلاه هو مجرد نظرة قصيرة ومختصرة للموضوع.

إذا كنت ترغب في معرفة المزيد حول هذا الموضوع المرتبط بموضوعات مختلفة مثل علم الوراثة والبيولوجيا الجزيئية وبيولوجيا الخلية ، فتفضل بزيارة موقع myassignmenthelp.net.

إنه موقع على الإنترنت يعتمد على البحث والتكنولوجيا المتطورة. لدينا فريق من المدرسين المجتهدين وذوي الخبرة من المجال المعني ، وسوف يقدمون لك جميع المعلومات حول تسلسل الحمض النووي بطريقة مرتبة لسهولة استيعابها. خدمتنا صديقة للطلاب لأن التفاعل بين المعلم والطلاب دائمًا ما يكون فعالًا ومثيرًا للإعجاب ويحل الشك.

نحن نعمل وفقًا لمنهجك الدراسي وإرشاداتك حول هذا الموضوع ، والآن إذا كانت لديك مشكلة في كتابة الواجبات ، فيمكنك الانضمام إلى موقع المساعدة الخاص بالمهام. نحن نؤمن بالعمل بجودة عالية ، وبالتالي فإن جميع المواد المقدمة لدينا ستصف لك الموضوع بأفضل طريقة ممكنة وتجعلك تتعلم الأشياء بطريقة واضحة تمامًا.

لم نحصر خدمتنا فقط في توفير العمل المكتوب لك ، ولكن أعضاء هيئة التدريس الممتازين لدينا سوف يعطونك أيضًا دروسًا خصوصية عبر الإنترنت ، وبالتالي حل جميع شكوكك والخروج بمناقشة فعالة.

يحتوي تسلسل الحمض النووي على طرق وعمليات مختلفة ، ولكن التواصل مع معلمنا سيسهل عليك تعلم الأشياء وتذكرها حتى في فترة زمنية قصيرة ، وستعزز درجاتك بلا شك بكل الأعمال المكتوبة التي قدمها لك فريقنا .

انضم إلينا وكن مرتاحًا لأن لدينا حلًا لجميع مشاكلك من شأنه أن يرشدك إلى قاعدة أفضل وراسخة حول هذا الموضوع.


تسلسل الحمض النووي بطريقة ديديوكسي

في تفاعل تسلسل dideoxy الأساسي ، يتم تلدين مادة أولغنوكليوتيد إلى قالب DNA أحادي الجديلة وتمديدها بواسطة بوليميريز الحمض النووي في وجود أربعة فوسفات ديوكسي ريبونوكليوزيد (dNTPs) ، أحدها يحمل علامة 35S. يحتوي التفاعل أيضًا على واحد من أربعة فوسفات ثنائي أوكسي ريبونوكليوزيد (ddNTPs) ، والتي تنهي الاستطالة عند دمجها في سلسلة الحمض النووي المتنامية. بعد الانتهاء من تفاعلات التسلسل ، تخضع المنتجات لرحلان كهربائي على هلام بولي أكريلاميد عالي الدقة يفسد الطبيعة ثم يتم تصويره تلقائيًا لتصور تسلسل الحمض النووي. يتم حاليًا استخدام ثلاثة أشكال مختلفة من إجراء تسلسل dideoxy ويتم تقديمها في هذه الوحدة. في إجراء "وضع العلامات / الإنهاء" ، يتم في البداية تمديد سلاسل التمهيدي وتمييزها في حالة عدم وجود إنهاء ddNTP ، بينما في إجراء "Sanger" التقليدي ، يتم وضع العلامات وإنهاء سلاسل التمهيدي في خطوة واحدة. الاختلاف الأخير في طريقة تسلسل dideoxy هو تسلسل الدورة الحرارية حيث يتعرض خليط التفاعل ، الذي يحتوي على قالب DNA ، التمهيدي ، بوليميراز DNA القابل للحرارة ، dNTPs ، و ddNTPs ، لجولات متكررة من التمسخ ، التلدين ، وخطوات الاستطالة. يسمح التضخيم الخطي الناتج عن منتجات التسلسل باستخدام قالب أقل بكثير من الحمض النووي ويقضي على التلدين التمهيدي المستقل وخطوات تمسخ القالب ، والتي تكون مطلوبة لإجراءات الوسم / الإنهاء أو Sanger. كما تم وصف استخدام متواليات الفلورسنت الآلية لتسلسل الحمض النووي ثنائي أكسيد الكربون بأربعة ألوان بالتفصيل.


تسلسل سانجر:

طور سانجر وزملاؤه طريقة إنهاء سلسلة لتسلسل الحمض النووي ، بعد بضع سنوات من طريقة ماكسام وجيلبرتس. تُعرف الطريقة أيضًا باسم طريقة تسلسل الجيل الأول من الحمض النووي.

ال طريقة إنهاء السلسلة يشار إليه أيضًا باسم أ تسلسل ديديوكسينوكليوتيد بسبب استخدام أنواع خاصة من ddNTPs. تختلف ddNTPs عن dNTPs العادي. تمتلك مجموعة الهيدروجين بدلاً من مجموعة الهيدروكسيل في dNTPs.

تمثل الصورة الفرق بين سكر الريبوز وسكر الديوكسيريبوز وسكر ديديوكسيريبوز.

لا يمكن أن تتشكل رابطة الفوسفوديستر بين نيوكليوتيدات متجاورة بسبب عدم وجود مجموعة الهيدروكسيل في ddNTPs. لا يمكن لسلسلة النيوكليوتيدات التخليق أكثر ، ومن ثم تُعرف باسم طريقة إنهاء السلسلة.

  1. استخراج الحمض النووي: باستخدام أي من بروتوكولات استخراج الحمض النووي
  2. تضخيم PCR: استخدام الاشعال المرافقة ، dNTPs ، ddNTPs ، بوليميراز DNA Taq و PCR العازلة.
  3. تحديد الشظايا المضخمة: باستخدام التصوير الشعاعي الذاتي ، PAGE ، أو الرحلان الكهربائي للهلام الشعري.

تبدأ عملية إنهاء السلسلة باستخراج وتنقية الحمض النووي. يمكن تحقيق استخلاص الحمض النووي باستخدام طريقة بروتيناز K أو طريقة استخراج الحمض النووي الفينول كلوروفورم. أو يمكننا استخدام طريقة الطقم القائمة على عمود السيليكا الجاهزة للاستخدام أيضًا.

الهدف الرئيسي من أي طريقة لاستخراج الحمض النووي هو تحقيق النقاء القريب

1.8 والكمية أكثر من 100ng.

يحتوي كل أنبوب على نفس الكمية من كواشف PCR ولكن في كل أنبوب ، تتم إضافة ddNTPs إضافية كما هو موضح في الجدول.

البادئات المحيطة هي مثل هذا التمهيدي الذي يرتبط بالمنطقة القريبة من تسلسل اهتمامنا أو تسلسل ما سنقرأه.

الآن في الخطوة التالية ، يضيف بوليميراز DNA Taq dNTPs إلى حبلا DNA.

هنا ، ليست هناك حاجة إلى بوليميراز الحمض النووي عالي الدقة. يوسع بوليميراز Taq الطبيعي حبلا DNA المتنامي عن طريق إضافة dNTPs. ومن المثير للاهتمام ، أنه بمجرد إضافة ddNTP بدلاً من dNTP ، يتم إيقاف توسيع السلسلة أو إنهاؤها.

اكتملت عملية الإنهاء في 4 أنابيب مختلفة لـ 4 ddNTPs مختلفة. على سبيل المثال ، في أنبوب ddATP ، فإنه ينهي السلسلة في جميع المواضع حيث سيتم ربط dATPs.

يتم تحميل نواتج تفاعل البوليميراز المتسلسل (PCR) المُضخّمة على البولي أكريلاميد الكهربائي للهلام. تنتقل شظايا الحمض النووي إلى الهلام بناءً على حجم الأجزاء. تعمل الأجزاء الصغيرة بشكل أسرع باتجاه الشحنة الموجبة من الأجزاء الأكبر.

قبل تشغيل PAGE ، يتم تغيير طبيعة أجزاء الحمض النووي المتضخمة عن طريق الحرارة. اعتمادًا على أنواع الملصقات ، يتم تحليل الهلام بعد ذلك تحت ضوء الأشعة فوق البنفسجية أو فيلم الأشعة السينية. يظهر نمط النطاقات للمنتج المضخم في الشكل أدناه ،

طريقة إنهاء سلسلة سانجرز لتسلسل الحمض النووي.

تسلسل سانجر هو الأسلوب القياسي الذهبي للبحث وكذلك في التشخيص ، في الوقت الحاضر. بسبب سهولة الإعداد وقابلية استنساخ عالية. أتمتة ذلك بسهولة.

تقليديًا ، يتم تفسير النتائج يدويًا على PAGE ولكن الآن يتغير السيناريو. العملية مؤتمتة كليًا أو جزئيًا. يكتشف الكاشف إشارات التألق في كل مرة يتم فيها إنهاء السلسلة. علاوة على ذلك ، يتم تسجيل الإشارات وتحليلها حسابيًا.

يولد البرنامج الحسابي قمم مضان مختلفة اعتمادًا على كمية التألق المنبعثة. يظهر الرسم التوضيحي الافتراضي لنتائج تسلسل سانجر في الشكل أدناه ،

كيف تفسر نتيجة PAGE لتسلسل Sanger؟

هذا القسم مهم للغاية ، وسوف أعلمك كيف يمكنك تفسير نتائج التسلسل. على الرغم من أنه نوع من النظرة العامة.

الآن ألق نظرة على الشكل أعلاه ،

ينص مبدأ الرحلان الكهربائي على أن شظايا الحمض النووي الأصغر تهاجر أسرع من الجعة. إذن فالجزء الموجود في الجانب الموجب هو الأصغر. ابدأ بقراءة التسلسل من ذلك.

النقطة الأولى في تسلسل الحمض النووي هي مطابقة حجم الحمض النووي. إذا كانت العصابات التي تم الحصول عليها في الهلام وتسلسل النوكليوتيدات في الحمض النووي الخاص بنا متشابهة ، فإن التفاعل يكتمل بشكل صحيح. على سبيل المثال ، إذا كان طول التسلسل الخاص بك هو 16 ، فيجب أن يكون هناك 16 نطاقًا في الهلام.

ابدأ القراءة من الأسفل. يبدأ تسلسل الحمض النووي بالحرف "C" باعتباره الجزء الأخير من الحمض النووي المنتهي بـ ddCTP. رتب التسلسل الموضح في الشكل وفقًا لذلك.


في آلات التسلسل الشعري ، يتم فصل شظايا الحمض النووي بالحجم من خلال أنبوب شعري طويل ورفيع من ألياف الأكريليك (بدلاً من هلام الرحلان الكهربائي ، كما هو الحال مع طريقة سانجر).

  1. يتم حقن عينة تحتوي على أجزاء من الحمض النووي في الشعيرات الدموية. يتم ذلك عن طريق غمس الشعيرات الدموية والقطب الكهربي في محلول العينة ، وتطبيق تيار كهربائي لفترة وجيزة. هذا يتسبب في هجرة شظايا الحمض النووي إلى نهاية الشعيرات الدموية.
  2. بمجرد حقن العينة ، يتم إعادة تطبيق المجال الكهربائي لدفع شظايا الحمض النووي عبر الشعيرات الدموية.
  3. ليزر كاشف للفلورة ، مدمج في الجهاز ، ثم يطلق النار عبر الألياف الشعرية ، مما يتسبب في تألق العلامات الملونة على شظايا الحمض النووي. يتم تمييز كل فاصل أساسي بلون مختلف: A = أخضر ، C = أزرق ، G = أصفر و T = أحمر.
  4. يتم الكشف عن لون قواعد الفلورسنت بواسطة الكاميرا ، ويتم تسجيله بواسطة آلة التسلسل.
  5. يتم بعد ذلك عرض ألوان القواعد على جهاز كمبيوتر كرسم بياني لقمم ملونة مختلفة. مثل هذه:

رصيد الصورة: Genome Research Limited

يسمح القطر الصغير للشعيرات الدموية باستخدام مجالات كهربائية عالية للغاية ، وبالتالي ، الفصل السريع جدًا لشظايا تسلسل الحمض النووي.


تسلسل البندقية والتعامل مع أقسام التكرار والرسوم المتحركة ثلاثية الأبعاد مع السرد الأساسي

قام المشروع الخاص بتفجير الجينوم إلى أجزاء مختلفة الأحجام واستخدم نماذج رياضية وخرائط أخرى لإعادة بناء الجينوم من هذه القطع. (موقع DNAi: Genome & gt The Project & gt وضعه معًا & gt Animations & gt Whole genome gungun-private)

تسلسل البندقية هو الطريقة التي استخدمها مشروع الجينوم الخاص. يتطلب تسلسل البندقية نسخًا متعددة من الجينوم ، والتي يتم تفجيرها بشكل فعال إلى ملايين الشظايا الصغيرة. ثم يتم تسلسل كل جزء. يتم تجميع الأجزاء الصغيرة باستخدام قدر هائل من طاقة الكمبيوتر لمطابقة الأقسام المتداخلة. يأتي عيب هذه الطريقة عند التعامل مع تسلسلات التكرار. غالبًا لا توجد طريقة لمعرفة طول تسلسل التكرار أو في أي من المواضع المختلفة الممكنة تتداخل الأجزاء. حتى البرامج القوية بشكل لا يصدق المستخدمة في تسلسل الجينوم البشري لم تستطع التعامل مع هذا. لذا ، كان على شركة Celera ، الشركة الخاصة التي اعتمدت على هذا النهج ، استخدام البيانات العامة لملء الفجوات التي خلفتها التكرارات.

تسلسل البندقية ، البرمجيات القوية ، قوة الكمبيوتر ، مشروع الجينوم ، الجينوم البشري ، الشظايا ، العيب ، السرد ، الشظية ، الشركة الخاصة ، الفجوات ، التسلسلات ، الرسوم المتحركة

المحتوى ذو الصلة

15477. مشروع الجينوم البشري العام: رسم خرائط الجينوم والتسلسل وإعادة التجميع. 3d الرسوم المتحركة.

مشروع الجينوم البشري العام: رسم خرائط الجينوم والتسلسل وإعادة التجميع.

15367. استخدام بيانات من المشروع العام كريج فنتر

يتحدث Craig Venter ، قائد الجهود الخاصة في Celera Genomics ، عن اعتماد شركته على البيانات العامة لإعادة تجميع تسلسل Celera.

15365. بندقية الجينوم الكامل ، كريج فنتر

يتحدث كريج فنتر ، قائد جهود الجينوم الخاص ، عن تقنية "بندقية الجينوم الكاملة" التي استخدمتها سيليرا جينوميكس لتسلسل الجينوم البشري.

15538. تسلسل الجينوم: تقنية البندقية ، الرسوم المتحركة ثلاثية الأبعاد بدون صوت

تسلسل الجينوم: تقنية البندقية.

16812. الرسوم المتحركة 39: الجينوم هو مجموعة كاملة من الجينات.

يصف جيمس واتسون تسلسل الجينوم البشري باستخدام علامات و BACs ، ويشرح Craig Venter استخدام مكتبات cDNA و ESTs وتسلسل البنادق.

15340. كان مشروع الجينوم البشري أكثر من مجرد التسلسل ، آري باترينوس

آري باترينوس ، مدير جهود التسلسل في وزارة الطاقة الأمريكية ، يتحدث عن أهداف مشروع الجينوم العام التي تجاوزت أهداف المشروع الخاص.

15479. طريقة سانجر لتسلسل الحمض النووي ، الرسوم المتحركة ثلاثية الأبعاد مع السرد

تشكل طريقة تسلسل الحمض النووي التي طورها فريد سانجر أساس تفاعلات تسلسل "الدورة" الآلية اليوم.

15169. عملية التسلسل العام ، جون سولستون

يتحدث جون سولستون الحائز على جائزة نوبل ، وهو شخصية رئيسية في جهود التسلسل في المملكة المتحدة ، عن تفكيك الحمض النووي بحيث يمكن إعادة تجميع التسلسل.

15291. إيجاد الجينات في الجينوم البشري ، إيوان بيرني

بالنسبة للمسودة الأولى لتسلسل الجينوم ، كان كلا الفريقين يعملان على تحديد عدد الجينات البشرية. هنا ، يشرح إيوان بيرني ، "رجل الأرقام" من مشروع الجينوم العام ، كيف يمكن التعرف على الجينات واستخدام البيانات من مشروع الجينوم.


قد يعجبك ايضا

تستخدم الفئران المعدلة وراثيا لدراسة وظيفة الجينات وتنظيم الجينات. وفي البحث في البيولوجيا الجزيئية ، يعد تحليل تسلسل الحمض النووي أساسًا لمزيد من البحث وتعديل الجينات المستهدفة. cdgenomics 11 أكتوبر 2015

لقد لاحظت هنا أنها ذكرت طرق البندقية ولكن ليس طرقًا أخرى مثل سانجر أو تسلسل الجيل التالي. لماذا ا؟ seHiro 15 يونيو 2011

@ TheGraham - مهلاً ، أعتقد أنه يمكنني الإجابة على هذا السؤال حول ما إذا كانت معلومات GenBank كلها تأتي من مشروع الجينوم البشري. إجابة بسيطة وبسيطة: كلا.

لم يكن بإمكان GenBank الحصول على هذا الحجم الهائل إلا من خلال السماح للناس بالتعاون بقدر ما يريدون. تحتوي قاعدة البيانات على بعض ضوابط الجودة الصارمة للغاية - ستفحص عن كثب كل شيء قبل إضافته إلى قاعدة البيانات - لكنها تعمل على إرسال البيانات من المعامل الفردية بالإضافة إلى كميات المعلومات التي توفرها مراكز التسلسل الجيني.

أعتقد أن GenBank فكرة رائعة ، حتى لو لم أفهم حقًا أشياء التسلسل الجيني هذه جيدًا. المعلومات هي رطانة بالنسبة لي ، لكنني متأكد من أنها مثل كنز مدفون لعالم. TheGraham 13 يونيو 2011

يتحدث عدد قليل من الأشخاص هنا عن GenBank ، الذي قرأته من قبل ، وأردت أن أذكر أنه على الرغم من أن المشروع يسمى & quot The Human Genome Project & quot ، إلا أنه لا يرسم فقط تسلسل الجينات البشرية.

قام مشروع الجينوم البشري أيضًا برسم الحمض النووي للحيوانات التي يشار إليها عادةً للتجارب العلمية ، مثل ذباب الفاكهة وفئران المختبر. أيضًا ، لست متأكدًا مما إذا كانت البيانات تأتي من مشروع الجينوم البشري ، لكن GenBank يضم مئات الآلاف من التسلسلات الأخرى أيضًا ، بما في ذلك الكثير من الميكروبات.

اعتبارًا من عام 2011 ، لا يحتفظ GenBank فقط بجميع معلومات رسم الخرائط الجينية التي توصلنا إليها من قبل للحمض النووي البشري ، ولكن أيضًا تسلسل النيوكليوتيدات لأكثر من 300000 كائن حي آخر ، مع استكمال الملاحظات البحثية الداعمة من الكتب وحتى التعليقات التوضيحية من الباحثين. يا لها من ثروة مذهلة من المعلومات العلمية هناك! hanley79 11 يونيو 2011

malmal - لا أعرف عن كل عملية تسلسل جيني على هذا الكوكب ، لكن مشروع الجينوم البشري لديه قاعدة بيانات واحدة كبيرة حيث يخزن تسلسل الحمض النووي المعين.

تسمى قاعدة البيانات GenBank ، وهي قاعدة البيانات الأولى الأكثر مرجعًا للبحث البيولوجي في أي مكان في العالم. كما يوفر وصول مجاني ومفتوح للمجال العام إلى قاعدة البيانات بأكملها لأي شخص يزور موقع الويب الخاص به - رائع جدًا!

كان GenBank موجودًا منذ عام 1982 ، وقد نما إلى أكثر من 61 مليون تسلسل جيني على مر السنين.

في حال كان سؤالك حول الحرف & quotwhere & quot ، تذكر أننا نتعامل مع الإنترنت. نظرًا لأن قواعد بيانات الكمبيوتر لا يجب أن تكون جميعها في مكان واحد بفضل الإنترنت ، فإن أجهزة الكمبيوتر الفعلية التي تخزن قاعدة البيانات موجودة في الولايات المتحدة واليابان وأوروبا ، على الرغم من أن GenBank تقنيًا يقع تحت سلطة حكومة الولايات المتحدة الاختصاص القضائي.

أتمنى أن يساعد هذا في تهدئة الفضول قليلاً! إذا كنت مهتمًا بهذه الأشياء ، فعليك بالتأكيد البحث عن Genbank - القراءة عنها رائعة حقًا. malmal 10 يونيو 2011

@ turkay1 - ما قلته بشأن رسم خرائط الحمض النووي الصيني لـ 10000 ميكروب وما إذا كانت ستشاركه مع بقية العالم يجعلني أشعر بالفضول حقًا - أين نخزن كل أعمال الحمض النووي المعينة هذه؟ أعني ، هل هناك قاعدة بيانات واحدة كبيرة للجميع؟

أفترض أنه من المثالي جدًا التفكير في أن البلدان المختلفة سيكون لديها قاعدة بيانات عملوا عليها جميعًا معًا ، لكن يمكنني أن أصدق أن كل دولة لديها قاعدة بيانات كبيرة.

يبدو لي أنه إذا لم تكن هناك قاعدة بيانات رسمية لتسلسل الجينات تم إنشاؤها بالفعل لمشروع الجينوم هذا ، فقد لا يعرف الناس ما فعله الآخرون من قبل ويبدأون في رسم خرائط الحمض النووي الذي تم بالفعل تعيينه عن طريق الصدفة.

هل يوجد سجل من نوع ما تم تعيين الجينات له ، ولكن كل شخص يخزن بياناته الخاصة في قواعد بياناته المختلفة ، ربما؟ أنا فضولي للغاية الآن. aishia 8 يونيو 2011

يعد رسم خرائط الجينات أداة ثورية في العديد من المجالات ، لكنني أعتقد أن أحد أكثر الاستخدامات العملية لها هو استخدامه كأداة لمكافحة الجريمة.

باستخدام تسلسل الحمض النووي ، فإن رسم الخرائط الجينية هو الأسلوب الذي يسمح لخبراء الطب الشرعي بالتحقيق في مسرح الجريمة واختبار دمه هناك ، على سبيل المثال. في حالة أخرى ، يمكن استخدام رسم الخرائط الجينية لاختبار عينات السائل المنوي المأخوذة من ضحية الاغتصاب ثم تحديد المهاجم دون أدنى شك بدلاً من الاعتماد على المزيد من الشهادات والأدلة التقليدية.

تم تقديم رسم خرائط الحمض النووي كأداة للطب الشرعي في منتصف الثمانينيات ، وفي ذلك الوقت تمت الإشارة إليه باسم & quot؛ بصمات الأصابع & quot لأنه ، مثل بصمات الأصابع ، لا توجد عينتان من الحمض النووي متماثلتين تمامًا.

لم يساعد رسم الخرائط الجينية محققي الشرطة في القبض على المجرم المناسب فحسب ، بل أثبت أخيرًا براءة الآلاف من الأشخاص الذين سُجنوا خطأً بناءً على أدلة تحقيق من قبل الطب الشرعي للحمض النووي. من يقول أن العلم لا يؤثر على حياتنا اليومية؟ fify 8 يونيو 2011

نعم ، تقوم دول أخرى بإجراء التسلسل الجيني أيضًا. أعتقد أن اليابان وكندا والصين من بين الدول الكبرى. لكن معظم الأبحاث التي يتم إجراؤها حتى الآن تتم هنا في الولايات المتحدة في الواقع ، إنها ليست قابلة للمقارنة ، ربما تمتلك الولايات المتحدة مشروعات التسلسل الجيني أكثر بعشر مرات من اليابان. لذلك نحن بالتأكيد نقود العالم في هذا البحث.

تمول المعاهد الوطنية للصحة معظم مشاريعنا ، تليها وزارة الطاقة. أعتقد أن وزارة الزراعة تمول أيضًا بعض مشاريع التسلسل الجيني ، على الرغم من أنني لا أعرف مقدارها. لا أعتقد أنهم يمولون عن بُعد قريبًا مما تموله وزارة الطاقة. candyquilt 8 يونيو 2011

قرأت أن التسلسل الجيني لا يتم فقط على البشر ، بل تم إجراؤه على البكتيريا والحيوانات والحشرات والنباتات أيضًا. يعتقد بعض العلماء في الواقع أن التسلسل الجيني للبكتيريا والميكروبات الأخرى أكثر أهمية من التسلسل الجيني البشري أو الحيواني. أتفق مع ذلك نظرًا لأن العديد من الأمراض ناتجة عن الميكروبات ، فإن معرفة تسلسلها الجيني سيكون مفيدًا في صنع أدوية جديدة لمكافحتها.

قرأت عن مشروع ضخم يجري الآن في هذا الشأن. والمثير للدهشة أن ذلك لا يحدث في الولايات المتحدة ، بل في الصين. يعمل معهد جينوم بكين على تسلسل جينات 10000 ميكروب.

أتمنى حقًا أن يتم تنفيذ مشروع مماثل في الولايات المتحدة على الرغم من أنني أفترض أن معهد بكين سيشارك النتائج التي توصلوا إليها مع بقية العالم. أستطيع أن أرى هذا المشروع يصنع موجات في عالم الطب عند اكتماله ، ومن المحتمل أن تكون شركات الأدوية في الطابور للحصول على أيديهم عليه. الفيروز 8 يونيو 2011

أعتقد أن التسلسل الجيني بدأ بمشروع الجينوم البشري في أوائل التسعينيات. لم يكتشفوا تسلسل الحمض النووي فحسب ، بل أنشأوا أيضًا قاعدة بيانات لها تسمى GenBank.

الجزء الأكبر في قاعدة البيانات هذه هو أنها عامة بالكامل. لذلك أي عالم يقوم بعمل في هذا المجال يمكنه استخدامه.

ربما يرجع السبب في أن التسلسل قد وصل حتى الآن وأنه يمكننا الآن تشخيص الأمراض الوراثية في وقت مبكر جدًا بفضل قاعدة البيانات هذه. آمل أن نتمكن من منع العديد من هذه الأمراض في المستقبل القريب من خلال التسلسل الجيني.


شاهد الفيديو: Billy is not in favor of selling their bakery. Make It With You With Eng Subs (يونيو 2022).